Please use this identifier to cite or link to this item: http://dspace.cas.upm.edu.ph:8080/xmlui/handle/123456789/1540
Full metadata record
DC FieldValueLanguage
dc.contributor.authorCalugcug, Bea Barbara L.-
dc.contributor.authorVelasquez, Headly S.-
dc.date.accessioned2022-09-20T02:27:03Z-
dc.date.available2022-09-20T02:27:03Z-
dc.date.issued2009-02-
dc.identifier.urihttp://dspace.cas.upm.edu.ph:8080/xmlui/handle/123456789/1540-
dc.description.abstractRabies is a highly fatal viral disease transmitted through the saliva of infected animals, especially dogs and cats. In the Philippines, rabies is a serious public health problem, causing 200 to 500 deaths annually. This study was designed to develop a Reverse Transcription - Polymerase Chain Reaction (RT-PCR) protocol for the detection of rabies virus from human saliva. Specifically, this study aimed to optimize RT-PCR conditions such as primer pair combination and annealing temperature; validate the optimized protocol using human saliva samples; and determine the limit of detection. SuperScript ® III Reverse Transcriptase Platinum® Taq DNA polymerase was used for the RT-PCR run and QIAGEN RNeasy extraction kit was used for the extraction of RNA from human saliva samples. Results showed that the RT-PCR protocol developed was useful for the diagnosis of rabies virus using human saliva. The best primer pair combination is the forward primer JW 12(C) (ATGTAACACCCCTACAATG); and reverse primer JW6(DPL) (CAATTCGCACACATTTTGTG). The optimum annealing temperature for this primer pair combination is 60°C. The protocol developed is useful for a template concentration of 58 pg/mL.en_US
dc.titleDevelopment of Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Protocol for The Detection of Rabies Virus from Human Salivaen_US
dc.typeThesisen_US
Appears in Collections:BS Biology Theses

Files in This Item:
File Description SizeFormat 
C207.pdf
  Until 9999-01-01
62.09 MBAdobe PDFView/Open Request a copy


Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.