Please use this identifier to cite or link to this item:
http://dspace.cas.upm.edu.ph:8080/xmlui/handle/123456789/1540
Full metadata record
DC Field | Value | Language |
---|---|---|
dc.contributor.author | Calugcug, Bea Barbara L. | - |
dc.contributor.author | Velasquez, Headly S. | - |
dc.date.accessioned | 2022-09-20T02:27:03Z | - |
dc.date.available | 2022-09-20T02:27:03Z | - |
dc.date.issued | 2009-02 | - |
dc.identifier.uri | http://dspace.cas.upm.edu.ph:8080/xmlui/handle/123456789/1540 | - |
dc.description.abstract | Rabies is a highly fatal viral disease transmitted through the saliva of infected animals, especially dogs and cats. In the Philippines, rabies is a serious public health problem, causing 200 to 500 deaths annually. This study was designed to develop a Reverse Transcription - Polymerase Chain Reaction (RT-PCR) protocol for the detection of rabies virus from human saliva. Specifically, this study aimed to optimize RT-PCR conditions such as primer pair combination and annealing temperature; validate the optimized protocol using human saliva samples; and determine the limit of detection. SuperScript ® III Reverse Transcriptase Platinum® Taq DNA polymerase was used for the RT-PCR run and QIAGEN RNeasy extraction kit was used for the extraction of RNA from human saliva samples. Results showed that the RT-PCR protocol developed was useful for the diagnosis of rabies virus using human saliva. The best primer pair combination is the forward primer JW 12(C) (ATGTAACACCCCTACAATG); and reverse primer JW6(DPL) (CAATTCGCACACATTTTGTG). The optimum annealing temperature for this primer pair combination is 60°C. The protocol developed is useful for a template concentration of 58 pg/mL. | en_US |
dc.title | Development of Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Protocol for The Detection of Rabies Virus from Human Saliva | en_US |
dc.type | Thesis | en_US |
Appears in Collections: | BS Biology Theses |
Files in This Item:
File | Description | Size | Format | |
---|---|---|---|---|
C207.pdf Until 9999-01-01 | 62.09 MB | Adobe PDF | View/Open Request a copy |
Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.